Request Demo

Last update 30 May 2025

Decitabine

Last update 30 May 2025

Overview

R&D Status

Clinical Result

Translational Medicine

Overview

Basic Info

Drug Type

Small molecule drug

Synonyms

2'-deoxy-5-azacytidine, 4-Amino-1-(2-deoxy-beta-D-erythro-pentofuranosyl)-1,3,5-triazin-2(1H)-one, 4-amino-1-(2-deoxy-β-D-erythro-pentofuranosyl)-s-triazin-2(1H)-one

+ [19]

Target

DNMT1

Action

inhibitors

Mechanism

DNMT1 inhibitors(DNA (cytosine-5)-methyltransferase 1 inhibitors)

Therapeutic Areas

NeoplasmsHemic and Lymphatic DiseasesOther Diseases+ [2]

Active Indication

Anemia, RefractoryAnemia, Refractory, With Excess of BlastsChronic Myelomonocytic Leukemia+ [19]

Inactive Indication

Acute Erythroblastic LeukemiaAcute Megakaryoblastic LeukemiaAcute Monocytic Leukemia+ [35]

Originator Organization

Eisai Co., Ltd.

Active Organization

Janssen-Cilag International NVOtsuka Pharmaceutical Development & Commercialization, Inc.

Merck Sharp & Dohme Corp.

+ [8]

Inactive Organization

Johnson & Johnson

Xian-Janssen Pharmaceutical Ltd.

Uman Pharma, Inc.

+ [10]

License Organization

Janssen Pharmaceuticals, Inc.

Janssen Korea Ltd.MGI PHARMA, Inc.

+ [5]

Drug Highest PhaseApproved

First Approval Date

United States (02 May 2006),

Anemia, Refractory, With Excess of BlastsAnemia, RefractoryChronic Myelomonocytic Leukemia+ [2]

RegulationOrphan Drug (United States), Orphan Drug (European Union)

Structure/Sequence

Molecular FormulaC8H12N4O4

InChIKeyXAUDJQYHKZQPEU-KVQBGUIXSA-N

CAS Registry2353-33-5

450

Clinical Trials associated with Decitabine

NCT06474663

/ Not yet recruitingPhase 1IIT

A Phase I Study Investigating the Combination of Cladribine, Low Dose Cytarabine and Sorafenib Alternating with Decitabine in Pediatric Relapsed and Refractory Acute Leukemias

To find the recommended dose of the drug combination cladribine, cytarabine, decitabine, and sorafenib in participants with relapsed/refractory AML, MPAL, and ALAL.

Start Date31 Dec 2025

Sponsor / Collaborator

The University of Texas MD Anderson Cancer Center

NCT03184935

/ SuspendedPhase 1/2

Research for Human Umbilical Cord Mesenchymal Stem Cells in the Treatment of Myelodysplastic Syndrome (MDS)

The purposes of the study is to determine the safety and efficacy of human umbilical cord mesenchymal stem cells (hUC-MSC) in treating Myelodysplastic Syndrome patients.

Start Date31 Dec 2025

Sponsor / Collaborator

Sclnow Biotechnology Co., Ltd.

NCT06928662

/ Not yet recruitingPhase 1/2IIT

Sequential Decitabine in Combination With FLAG-Ida Followed Immediately by Reduced-Intensity Conditioning (RIC) Allogeneic Hematopoietic Cell Transplantation (DEC-FLAG-Ida/RIC) for Adults With Myeloid Malignancies at High Risk of Relapse: A Phase 1/2 Study

This phase I/II trial studies the safety, side effects, and best dose of decitabine in combination with fludarabine, cytarabine, filgrastim, and idarubicin (FLAG-Ida) and total body irradiation (TBI) followed by a donor stem cell transplant in treating adult patients with cancers of blood-forming cells of the bone marrow (myeloid malignancies) that are at high risk of coming back after treatment (relapse). Cancers eligible for this trial are acute myeloid leukemia (AML), myelodysplastic syndrome (MDS), and chronic myelomonocytic leukemia (CMML). Decitabine is in a class of medications called hypomethylation agents. It works by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. The FLAG-Ida regimen consists of the following drugs: fludarabine, cytarabine, filgrastim, and idarubicin. These are chemotherapy drugs that work in different ways to stop the growth of cancer cells, either by killing the cells, by stopping them from dividing, or by stopping them from spreading. Filgrastim is in a class of medications called colony-stimulating factors. It works by helping the body make more neutrophils, a type of white blood cell. Radiation therapy uses high energy x-rays, particles, or radioactive seeds to kill cancer cells and shrink tumors. TBI is radiation therapy to the entire body. Giving chemotherapy and TBI before a donor peripheral blood stem cell (PBSC) transplant helps kill cancer cells in the body and helps make room in the patient's bone marrow for new blood-forming cells (stem cells) to grow. When the healthy stem cells from a donor are infused into a patient, they may help the patient's bone marrow make more healthy cells and platelets. Giving decitabine in combination with FLAG-Ida and TBI before donor PBSC transplant may work better than FLAG-Ida and TBI alone in treating adult patients with myeloid malignancies at high risk of relapse.

Start Date01 Sep 2025

Sponsor / Collaborator

Fred Hutchinson Cancer Research Center

100 Clinical Results associated with Decitabine

100 Translational Medicine associated with Decitabine

100 Patents (Medical) associated with Decitabine

9,486

Literatures (Medical) associated with Decitabine

31 Dec 2025·Hematology

Efficacy and safety of decitabine combined with arsenic trioxide in elderly high-risk myelodysplastic neoplasm patients: a retrospective study

Article

Author: Yang, Jianzhong

OBJECTIVES:

Elderly patients with high-risk myelodysplastic neoplasm (MDS) face poor outcomes with limited treatment options, often progressing to acute myeloid leukemia (AML). This study investigates the efficacy and safety of combining decitabine (DAC) with arsenic trioxide (ATO) as a novel therapeutic approach.

METHODS:

A retrospective analysis was conducted on 120 elderly high-risk MDS patients, with 52 receiving ATO-DAC (ATO-DAC group) and 68 receiving DAC monotherapy (DAC group). Treatment outcomes were assessed through overall response rate (ORR), progression-free survival (PFS), and overall survival (OS). Adverse events were recorded and compared between the two groups.

RESULTS:

The ATO-DAC group demonstrated a significantly higher ORR of 78.85% compared to 52.94% in the DAC group (P = 0.026). Median PFS was 7.5 months for the ATO-DAC group versus 5.0 months for the DAC group (P = 0.021), and median OS was 14.5 months compared to 11.5 months, respectively (P = 0.034). Although adverse events were more frequent in the ATO-DAC group, the safety profile remained manageable. These findings suggest that the ATO-DAC combination provides superior efficacy compared to DAC monotherapy.

DISCUSSION:

The combination of DAC and ATO offers a promising and innovative treatment option for elderly high-risk MDS patients, enhancing response rates and survival outcomes while maintaining a manageable safety profile.

CONCLUSION:

This study underscores the clinical relevance of this regimen, warranting further investigation in prospective trials.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

01 Jul 2025·WASTE MANAGEMENT

Ecotoxicological impact of deactivated asbestos-cement on soil ecosystems

Article

Author: Saldi, Erica ; Negri, Ilaria ; Capitani, Giancarlo

The effects of thermally deactivated asbestos cement (DAC) on the soil ecosystem were evaluated using the soil model organism Folsomia candida (Collembola). Two materials were obtained by treating asbestos cement slates, commonly used for roofing, at 1100 °C under oxidizing conditions (Red DAC) and at 1150 °C under reducing conditions (Green DAC). Ten age-synchronized juveniles of F. candida were exposed to DAC powder:soil mixtures in ratios of 1:1 and 1:10 for both types. After 28 days, adults and juveniles were counted to assess treatment effects. The results indicate distinct toxicity profiles. The Red powder did not induce adult lethality at the tested concentrations; however, a significant reduction in juvenile production was observed at the higher concentration (1:1). In contrast, the Green powder caused adult lethality at 1:1 concentration, with no juveniles produced. Both materials contain a high percentage of silica glass (∼40% by weight), a well-known insect dehydration agent and mechanical insecticide. At the highest concentration, silica glass may cause detrimental effects on juveniles, which are more sensitive to dehydration than adults. Green DAC also contains 8.5% lime (CaO), an antimicrobial and insecticidal agent that can disrupt soil pH. The combination of silica-induced dehydration and lime-mediated alkalinity may account for the lethal effects of Green DAC on F. candida adults. These findings reinforce the need for proper DAC recycling. While asbestos deactivation effectively eliminates its hazard in the built environment, improper disposal or soil contamination may pose ecological risks. Recycling DAC into stable matrices, such as ceramics or mortar, minimizes environmental contamination while promoting circular economy.

160

News (Medical) associated with Decitabine

29 May 2025

·www.prnewswire.com

John Theurer Cancer Center Presents Innovative Cancer Research at Major Annual Cancer Meeting, Offering New Hope for Patients

Presentations and publications address novel therapeutics, molecular biology studies, and global trends for blood cancers and solid tumors HACKENSACK, N.J., May 29, 2025 /PRNewswire/ -- Investigators from Hackensack Meridian John Theurer Cancer Center (JTCC)—part of the National Cancer Institute-designated Lombardi Comprehensive Cancer Center at Georgetown University—and Hackensack University Medical Center are reporting research findings from 32 studies at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting. The meeting is the premier event for cancer professionals and takes place in Chicago from May 30 to June 3. "The future of cancer treatment begins with the pioneering exploration being carried out today," notes Andre Goy, MD, chair, vice president, physician-in-chief of oncology, at Hackensack Meridian John Theurer Cancer Center. "We are fortunate to be in a time where many cancers will respond to standard treatments. But for those cancers that don't, it's critical that patients have access to a world-class research program that will yield innovative therapies. At John Theurer Cancer Center, our globally recognized investigators continue to drive the latest oncology advances in cellular therapy, immunotherapy and other areas, enabling improved outcomes for patients across the Hackensack Meridian Health network and beyond." Several studies address novel drug combinations for multiple myeloma, as well as racial disparities in treatment outcomes and the expression of key biomarkers. Investigators are also presenting data on emerging immunotherapies for leukemia and lymphoma, molecular markers predicting disease relapse, and innovative treatment regimens such as all-oral therapies for acute myeloid leukemia. Solid tumor studies focus on disparities in gastric cancer, machine learning applications for breast cancer metastasis, and promising antibody-drug conjugates for lung cancer. Investigations related to melanoma and skin cancer examine circulating tumor DNA as a marker for disease progression, comparative survival analyses based on biomarkers, and the identification of targetable mutations across different skin cancer types. These findings underscore the breadth of ongoing efforts at John Theurer Cancer Center—New Jersey's largest cancer center—to refine therapeutic strategies, enhance precision oncology, and improve patient outcomes. Multiple Myeloma Research Carfilzomib, iberdomide, and dexamethasone in patients with transplant-eligible newly diagnosed multiple myeloma: Updated results from phase 1/2 study Updated results from phase 2b study of selinexor in combination with carfilzomib, daratumumab, or pomalidomide in patients with multiple myeloma relapsing on current therapy Real-world outcomes of patients with multiple myeloma treated with T-cell engagers compared to those treated on clinical trials Impact of racial disparities on efficacy and safety outcomes for patients with relapsing/refractory multiple myeloma receiving T-cell engagers Heterogeneity in the expression of GPRC5D between patients with multiple myeloma Evaluation of immune checkpoint inhibitors and concurrent radiation therapy for the treatment of extramedullary multiple myeloma Global burden of multiple myeloma: Analysis from 1980 to 2021 Efficacy and safety of less frequent dosing with elranatamab in patients with relapsed or refractory multiple myeloma: A US subgroup analysis from MagnetisMM-3 Leukemia and Lymphoma Peripheral blood cell-free DNA testing as a predictor for relapse post-allogeneic stem cell transplant for acute myeloid leukemia An all-oral regimen of decitabine-cedazuridine plus venetoclax in patients with newly diagnosed acute myeloid leukemia ineligible for intensive induction chemotherapy: Results from a phase 2 cohort of 101 pts Employing novel pan-cancer targets for immunotherapy in leukemias and solid tumors MRD negativity after end of induction in the phase 3 PhALLCON trial: A post hoc analysis Results from the completed dose-finding part of phase 2 study of the innate cell engager acimtamig (AFM13) in combination with AlloNK (AB-101) in relapsed or refractory classical Hodgkin lymphoma (LuminICE-203) Novel analysis of 3-y results from the pivotal EPCORE NHL-1 study: Outcomes in patients with relapsed/refractory large B-cell lymphoma and complete response at 2 years with epcoritamab monotherapy TITANium: An open-label, global multicenter phase 1/2 study of AZD5492, a first-in-class subcutaneous CD8-guided tri-specific T-cell engager, in patients with relapsed or refractory B-cell malignancies Solid Tumor Research Limited changes in the central nervous system immune microenvironment in patients with breast cancer metastasis and capturing these changes using machine learning Relationship between FOLR1 expression and pan-cancer subgroup of tumors with specific transcriptomic profile Disparities and trends in gastric cancer: Incidence, mortality, and stage-specific trends Prevalence of the HPV, EBV, and TTV viral RNA in the plasma of patients with solid and hematologic neoplasms and the detection of a specific immune signature Global trends in soft tissue and extraosseous sarcomas (1980–2021): Regional and economic disparities ZL-1310, a DLL3 antibody-drug conjugate, in patients with extensive stage small cell lung cancer: Phase 1 trial update Ongoing phase 1/2 trial of the hematopoietic progenitor kinase 1 (HPK1) inhibitor NDI-101150 as monotherapy or in combination with pembrolizumab: Clinical safety and efficacy update in clear cell renal cell carcinoma Ipilimumab and nivolumab in patients with metastatic clear cell renal cell carcinoma treated on the phase 3 PDIGREE (Alliance A031704) trial: Results from Step 1 analysis Initial safety and efficacy results from a first-in-human, phase 1/2 study of SAR445877, an anti-PD-1/IL-15 fusion protein, for patients with advanced solid tumors An open-label, phase I trial of the SIRPα monoclonal antibody, BI 770371, alone and in combination with the PD-1 inhibitor ezabenlimab in patients with advanced solid tumors A phase 1 dose escalation and dose expansion study for LNCB74, a B7-H4 targeted antibody drug conjugate, as monotherapy in participants with advanced solid tumors A phase 1, open-label, multi-center study of the safety, tolerability, and efficacy of IPH4502 as a single agent in advanced solid tumors A phase 2 safety and efficacy study of PRT3789 in combination with pembrolizumab in patients with advanced or metastatic solid tumors and a SMARCA4 mutation Phase 3, randomized, placebo-controlled clinical trial of CAN-2409+prodrug in combination with standard of care external beam radiation (EBRT) for newly diagnosed localized prostate cancer Melanoma and Other Skin Cancers Comparison of ctDNA and hematologic ratios as markers of disease progression in early versus late-stage melanoma: A single-center retrospective study Survival analysis based on markers of progression in melanoma: A single-center comparison of survival in patients with high vs low biomarkers Targetable mutations in cutaneous skin cancers: A comparative study across melanoma, squamous cell carcinoma, basal cell carcinoma, and Merkel cell carcinoma SOURCE Hackensack Meridian John Theurer Cancer Center WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

ASCOClinical ResultImmunotherapyPhase 1Phase 2

23 May 2025

·www.taiho.co.jp

Results of Clinical Study of the Combination Regimen of Decitabine and Cedazuridine Plus Venetoclax for Acute Myeloid Leukemia Announced at the American Society of Clinical Oncology Annual Meeting

Taiho Pharmaceutical Co., Ltd. announces that its U.S. subsidiary, Taiho Oncology, Inc., will present the results of a Phase 1/2 clinical trial of the combination regimen of decitabine and cedazuridine plus venetoclax for acute myeloid leukemia (AML) in an oral presentation at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting, to be held May 30 through June 3 in Chicago. This Phase 1/2 trial evaluated the safety and efficacy of an oral administration regimen of decitabine-cedazuridine paired with venetoclax in 101 adult　AML patients who were ineligible for first-line induction chemotherapy. Taiho Pharmaceutical Co., Ltd. announces that its U.S. subsidiary, Taiho Oncology, Inc., will present the results of a Phase 1/2 clinical trial of the combination regimen of decitabine and cedazuridine plus venetoclax for acute myeloid leukemia (AML) in an oral presentation at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting, to be held May 30 through June 3 in Chicago. This Phase 1/2 trial evaluated the safety and efficacy of an oral administration regimen of decitabine-cedazuridine paired with venetoclax in 101 adult　AML patients who were ineligible for first-line induction chemotherapy. Complete remission (CR), which was the primary endpoint of the study, was 46.5%, and CR with incomplete hematologic recovery rates was 63.4%. Median time to CR was 2.4 months. Median CR duration was not reached; among patients who achieved it, 80% maintained that status at 6 months and 75.3% at 12 months. Median OS was 15.5 months. 98% of patients reported treatment-emergent adverse events of grade 3 or lower, most commonly febrile neutropenia (49.5%), anemia (38.6%) and neutropenia (35.6%). The 30- and 60-day mortality rates were 3% and 9%, respectively. Complete remission (CR), which was the primary endpoint of the study, was 46.5%, and CR with incomplete hematologic recovery rates was 63.4%. Median time to CR was 2.4 months. Median CR duration was not reached; among patients who achieved it, 80% maintained that status at 6 months and 75.3% at 12 months. Median OS was 15.5 months. 98% of patients reported treatment-emergent adverse events of grade 3 or lower, most commonly febrile neutropenia (49.5%), anemia (38.6%) and neutropenia (35.6%). The 30- and 60-day mortality rates were 3% and 9%, respectively. AML is a disease in which the proliferation of leukemia cells inhibits the normal production of blood in the bone marrow. It is the most common type of acute leukemia in adults, and its incidence increases with age. There is a need for less toxic treatment methods for elderly patients who have difficulty receiving first-line induction chemotherapy. AML is a disease in which the proliferation of leukemia cells inhibits the normal production of blood in the bone marrow. It is the most common type of acute leukemia in adults, and its incidence increases with age. There is a need for less toxic treatment methods for elderly patients who have difficulty receiving first-line induction chemotherapy. This combination is the world's first oral DNA methylation inhibitor combined with a novel metabolic inhibitor that inhibits the breakdown of decitabine when administered orally. It was approved in the U.S. and Canada in 2020 for the indications of myelodysplastic syndromes (MDS) and chronic myelomonocytic leukemia (CMML), and in Europe in 2023 for the indication of AML. This combination is the world's first oral DNA methylation inhibitor combined with a novel metabolic inhibitor that inhibits the breakdown of decitabine when administered orally. It was approved in the U.S. and Canada in 2020 for the indications of myelodysplastic syndromes (MDS) and chronic myelomonocytic leukemia (CMML), and in Europe in 2023 for the indication of AML.

Clinical ResultDrug ApprovalASCOPhase 3

22 May 2025

·www.prnewswire.com

Taiho Oncology Presents Data at the 2025 American Society of Clinical Oncology Annual Meeting

Data will be shared in two oral presentations, a poster and two online abstracts Highlights include a potential novel, all-oral therapy for AML; and Phase 2 data for a novel treatment targeting NSCLC that harbors EGFR exon 20 insertion mutations PRINCETON, N.J., May 22, 2025 /PRNewswire/ -- Taiho Oncology, Inc., a company developing and commercializing novel treatments for hematologic malignancies and solid tumors, today announced new data to be presented at the 2025 American Society of Clinical Oncology (ASCO) Annual Meeting, May 30 through June 3 at McCormick Place in Chicago. An oral presentation will highlight data describing the combination of decitabine and cedazuridine paired with venetoclax as a potential all-oral regimen for acute myeloid leukemia (AML).1 "The design of an all-oral regimen for the treatment of AML is in line with our mission to improve the lives of patients with cancer, their families and their caregivers, giving patients access to anti-cancer agents that allow more flexibility in treatment," said Harold Keer, MD, PhD, Chief Medical Officer, Taiho Oncology. Another oral presentation will highlight positive safety and efficacy findings for the investigational drug candidate zipalertinib as a treatment for non-small cell lung cancer (NSCLC) harboring EGFR exon 20 insertion mutations.2 Taiho Oncology will also present data from three real-world studies of two FDA-approved therapies. "We're pleased to share these important data in several cancer types at the ASCO Annual Meeting," said Tim Whitten, President and CEO, Taiho Oncology. "Our purpose is grounded in ensuring we make a tangible impact for patients and their caregivers. These data continue to demonstrate our unwavering commitment to meaningful innovation across numerous disease states." Oral regimen of decitabine and cedazuridine plus venetoclax in newly diagnosed AML1 This Phase 1/2 trial evaluated the regimen of decitabine and cedazuridine plus venetoclax in 101 patients with newly diagnosed AML who were ineligible for first-line induction chemotherapy. Complete remission (CR) and CR with incomplete hematologic recovery rates were 46.5% and 63.4%, respectively. Median time to CR was 2.4 months. Median CR duration was not reached; among patients who achieved CR, 80% maintained that status at 6 months and 75.3% at 12 months. Median OS was 15.5 months. Ninety-eight percent of patients reported treatment-emergent adverse events of grade 3 or lower, most commonly febrile neutropenia (49.5%), anemia (38.6%) and neutropenia (35.6%). The 30- and 60-day mortality rates were 3% and 9%, respectively. Zipalertinib in NSCLC harboring EGFR exon 20 insertion mutations2 The Phase 2b REZILIENT1 study of zipalertinib monotherapy in patients with NSCLC harboring the EGFR exon 20 insertion mutations who have received prior therapy met its primary endpoint of overall response rate. The overall efficacy population (n=176) consisted of all patients who received at least one dose of 100 mg zipalertinib at data cutoff in December 2024. Patients had received a median of two prior therapies, and 38.6% of patients had a history of brain metastases. With median follow-up of 9.3 months, zipalertinib demonstrated: Among all patients treated, zipalertinib demonstrated a confirmed overall response rate (cORR) of 35.2%, with a median duration of response (mDOR) of 8.8 months. In patients who had received previous chemotherapy only (n=125), the cORR was 40.0%. Among patients with brain metastases, the systemic cORR was 30.9%. In patients with prior chemo and amivantamab (without the addition of other prior ex20ins-targeted therapy) (n=30), confirmed ORR was 30%. In a larger group of patients, including patients with prior chemo and amivantamab (with or without other ex20ins-targeted therapy) (n=51), ORR was 23.5 % with mDOR of 8.5 months. The most common treatment-emergent AEs were paronychia, rash, anemia, diarrhea, dry skin, nausea and stomatitis and the majority of TEAEs were CTCAE grade 1 or 2. Poster Presentation Title: Real-world treatment patterns and outcomes with trifluridine/tipiracil monotherapy or in combination with bevacizumab in metastatic colorectal cancer Abstract Number: 3580 Session Name: Gastrointestinal Cancer—Colorectal and Anal Session Type: Poster Presentation Session Date: May 31, 2025 Presentation Time: 9 a.m. – 12 p.m. CDT Location: Hall A - Posters and Exhibits | On Demand Presenter: Donald Richards, MD, PhD, of Texas Oncology Online Abstracts Title: Real-world Clinical Outcomes of Patients with Metastatic Colorectal Cancer (mCRC) Treated with Trifluridine-Tipiracil + Bevacizumab by Performance Status Abstract Number: E15606 Session Type: Publication Only Publication Date: May 22, 2025 Publication Time: 5 p.m. EDT Lead Author: Maliha Nusrat, MD, MS, Memorial Sloan Kettering Cancer Center Title: Real-World patient characteristics and treatment patterns among cholangiocarcinoma patients treated with FGFR inhibitors Abstract Number: E16262 Session Type: Publication Only Publication Date: May 22, 2025 Publication Time: 5 p.m. EDT Lead Author: Amit Mahipal, MD, University Hospitals Seidman Cancer Center and Case Comprehensive Cancer Center About Zipalertinib Zipalertinib (development code: CLN-081/TAS6417) is an orally available small molecule designed to target activating mutations in EGFR. The molecule was engineered to inhibit EGFR variants with exon 20 insertion mutations, while sparing wild-type EGFR. Zipalertinib is designed as a next generation, irreversible EGFR inhibitor for the treatment of a genetically defined subset of patients with non-small cell lung cancer. Zipalertinib has received Breakthrough Therapy Designation from the FDA. Zipalertinib is being developed by Taiho Oncology, Inc., its parent company, Taiho Pharmaceutical Co., Ltd., and Cullinan Oncology, Inc. Cullinan Pearl Corp., which Taiho Pharmaceutical Co., Ltd., acquired from Cullinan Oncology, Inc. in 2022. About Taiho Oncology, Inc. The mission of Taiho Oncology, Inc. is to improve the lives of patients with cancer, their families and their caregivers. The company specializes in the development and commercialization of orally administered anti-cancer agents for various tumor types. Taiho Oncology has a robust pipeline of small-molecule clinical candidates targeting solid-tumor and hematological malignancies, with additional candidates in pre-clinical development. Taiho Oncology is a subsidiary of Taiho Pharmaceutical Co., Ltd. which is part of Otsuka Holdings Co., Ltd. Taiho Oncology is headquartered in Princeton, New Jersey and oversees its parent company's European and Canadian operations, which are located in Baar, Switzerland and Oakville, Ontario, Canada. For more information, visit , and follow us on LinkedIn and X. Taiho Oncology and the Taiho Oncology logo are registered trademarks of Otsuka Holdings Co., Ltd. or its subsidiaries. Taiho Oncology Contact: Leigh Labrie (609) 664-9878 [email protected] References: 1. Zeidan A et al. An all-oral regimen of decitabine-cedazuridine (DEC-C) plus venetoclax (VEN) in patients (pts) with newly diagnosed acute myeloid leukemia (AML) ineligible for intensive induction chemotherapy: Results from a Phase 2 cohort of 101 pts 2. Yu H et al. Efficacy of zipalertinib in NSCLC patients with EGFR exon 20 insertion mutations who received prior platinum-based chemotherapy with or without amivantamab SOURCE Taiho Oncology WANT YOUR COMPANY'S NEWS FEATURED ON PRNEWSWIRE.COM? 440k+ Newsrooms & Influencers 9k+ Digital Media Outlets 270k+ Journalists Opted In GET STARTED

ASCOPhase 2Clinical ResultBreakthrough TherapyAcquisition

100 Deals associated with Decitabine

External Link

KEGG	Wiki	ATC	Drug Bank
D03665	Decitabine	L01BC08	DB01262

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Acute Myeloid Leukemia	European Union	Janssen-Cilag International NV	20 Sep 2012
Acute Myeloid Leukemia	Iceland	Janssen-Cilag International NV	20 Sep 2012
Acute Myeloid Leukemia	Liechtenstein	Janssen-Cilag International NV	20 Sep 2012
Acute Myeloid Leukemia	Norway	Janssen-Cilag International NV	20 Sep 2012
Anemia, Refractory	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Anemia, Refractory, With Excess of Blasts	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Chronic Myelomonocytic Leukemia	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Refractory cytopenia with multilineage dysplasia and ringed sideroblasts	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006
Myelodysplastic Syndromes	United States	Otsuka Pharmaceutical Co., Ltd.	02 May 2006

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Secondary Myelodysplastic Syndrome	Phase 3	United States	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Austria	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Canada	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Czechia	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	France	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Germany	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Hungary	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Italy	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	Spain	Astex Pharmaceuticals, Inc.	15 Feb 2018
Secondary Myelodysplastic Syndrome	Phase 3	United Kingdom	Astex Pharmaceuticals, Inc.	15 Feb 2018

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


AACR2025	Not Applicable	-	-	decitabine (PCIF1 overexpression)	pcmsryjhkr(oyfopdtief) = significant klwetxulzt (tnvhtugwmj ) View more	Positive	28 Apr 2025
NCT02957968 (Pubmed \| J Immunother Cancer)	Phase 2	HER2-negative breast cancer Neoadjuvant TILs \| PD-L1	46	Decitabine + Pembrolizumab	dbxieajunv(ilukqejamc) = fiosoojxpj ibsujheoif (utvnotrvca ) View more	Positive	01 Feb 2025
				Standard Neoadjuvant Chemotherapy	dbxieajunv(ilukqejamc) = lblzkshkss ibsujheoif (utvnotrvca ) View more
ASH2024	Not Applicable	Myelodysplastic Syndromes	-	Oral Decitabine and Cedazuridine (DEC-C)	dnjkfkgddz(nocomraora) = xhqcmablvb gkbqnlpuob (ipahzpifbq ) View more	-	09 Dec 2024
				Intravenous/Subcutaneous Hypomethylating Agents (IV/SC HMA)	dnjkfkgddz(nocomraora) = rchydmwjkr gkbqnlpuob (ipahzpifbq ) View more
ASH2024	Not Applicable	-	-	Venetoclax	nmfzkjgmlq(xdednucgcr) = common adverse reactions including febrile neutropenia wpljlxjwba (ofsfjoacdg ) View more	-	09 Dec 2024
NCT05222984 (ASH2024)	Phase 1	Acute Myeloid Leukemia	-	Navitoclax/Venetoclax/Decitabine Combination	hmodfeeiud(jtxslsdzhk) = hrmnrrsjkk mmxxardahu (qgwjqtsdtr )	-	09 Dec 2024
2898Venetoclax (ASH2024)	Phase 1/2	Acute Myeloid Leukemia	40	Venetoclax + D-CAG regimen	eiiewzznny(knxlsjtoiz) = sjigcgyvel dlkcphvxpc (cgxfgqiker ) View more	Positive	08 Dec 2024
ASH2024	Not Applicable	Acute myeloid leukaemia with 11q23 abnormality	-	Intensified conditioning containing Decitabine	cisbrobxak(glcwaekyhq) = 1 (1.0%) patient in the intensified group died of heart toxicity esjdookvce (yuokztpgdr ) View more	-	07 Dec 2024
				Decitabine (Standard myeloablative conditioning)
ASH2024	Not Applicable	Acute Myeloid Leukemia	-	DCAG+UCB-MST+IL-2	hilsuflgse(ufylfqpicy) = yxyfturppr bkxhzgviea (kkwcfvpvvp ) View more	-	07 Dec 2024
				DCAG	hilsuflgse(ufylfqpicy) = csryleiijb bkxhzgviea (kkwcfvpvvp ) View more
NCT05184842 (Pubmed \| Blood)	Phase 2	Acute Myeloid Leukemia \| Chronic Myelomonocytic Leukemia \| Myelodysplastic Syndromes TP53-mutation	-	Decitabine and Venetoclax	bwhrzqamnl(wukfcgfhup) = mkwyegbcxw twxuqoqedd (fcqyspbovy )	Positive	28 Nov 2024
				Placebo	bwhrzqamnl(wukfcgfhup) = wvhxzbnbbs twxuqoqedd (fcqyspbovy )
SOHO2024	Not Applicable	Relapsing acute myeloid leukemia	-	Decitabine	kfkcxgjzjb(qtahyhznzb) = reported by the patient hwhemikhrz (lgxeqemsjj ) View more	-	04 Sep 2024

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

AI Agents Built for Biopharma Breakthroughs

Accelerate discovery. Empower decisions. Transform outcomes.

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis