RegulationBreakthrough Therapy (United States), Accelerated Approval (United States), Orphan Drug (United States), Orphan Drug (European Union), Special Review Project (China), Orphan Drug (Japan), Orphan Drug (Australia), Conditional marketing approval (China)

Structure/Sequence

Molecular FormulaC45H50ClN7O7S

InChIKeyLQBVNQSMGBZMKD-UHFFFAOYSA-N

CAS Registry1257044-40-8

831

Clinical Trials associated with Venetoclax

NCT07175415

/ Not yet recruitingPhase 1/2IIT

ITCC-104: HEM-iSMART International Proof of Concept Therapeutic Stratification Trial of Molecular Anomalies in Relapsed or Refractory HEMatological Malignancies in Children, Sub-Protocol E: Capivasertib + Venetoclax + Dexamethasone in Pediatric Patients With Relapsed or Refractory Hematological Malignancies

HEM-iSMART is a master protocol which investigates multiple investigational medicinal products in children, adolescents and young adults (AYA) with relapsed/refractory (R/R) ALL and LBL. Sub-protocol E is a phase I/II trial evaluating the safety and efficacy of capivasertib + venetocolax in combination with dexamethasone in children and AYA with R/R ped ALL/LBL whose tumor present with alterations of the PAM pathway, or lacking any mutations.

Start Date01 Oct 2026

Sponsor / Collaborator

Princess Maxima Centre For Pediatric Oncology

[+2]

NCT07153497

/ Not yet recruitingPhase 2IIT

A Randomized Phase 2 Trial of Olutasidenib-Based Therapies in Patients With Newly Diagnosed IDH1-Mutant Myeloid Malignancies: A MyeloMATCH Substudy

This phase II MyeloMATCH treatment substudy tests the addition of olutasidenib to usual treatment in patients with higher-risk myelodysplastic syndrome (MDS) or patients with acute myeloid leukemia (AML) with a mutation in the IDH1 gene. Olutasidenib blocks the protein made by the mutated IDH1 gene. Blocking this protein may help keep cancer cells from growing. For patients with MDS, olutasidenib will be added to decitabine-cedazuridine (also called ASTX727). Decitabine is in a class of medications called hypomethylating agents and is the standard treatment for MDS. It works by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. The cedazuridine makes it possible to take the decitabine by mouth. Adding olutasidenib to the usual treatment for MDS (ASTX727) may increase the likelihood of going into remission. For patients with AML, olutasidenib and ASTX727 will be combined with venetoclax, a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. Venetoclax may stop the growth of cancer cells by blocking BCL-2, a protein needed for cancer cell survival. Adding olutasidenib to the usual treatment for AML (ASTX727 and venetoclax) may increase the likelihood of going into remission. For low risk MDS, the substudy tests whether giving olutasidenib alone helps improve blood counts.

Start Date27 May 2026

Sponsor / Collaborator

National Cancer Institute

NCT06802523

/ SuspendedPhase 1IIT

A Phase I Study of Lintuzumab-Ac-225 in Combination With Venetoclax and ASTX-727 in Adults With Newly Diagnosed AML

This phase I trial tests the safety, side effects, and best dose of lintuzumab-Ac225 in combination with venetoclax and ASTX-727, and how well they work in treating patients with newly diagnosed acute myeloid leukemia (AML). Lintuzumab-Ac225 is a monoclonal antibody, called lintuzumab, linked to a radioactive agent called actinium Ac 225. Lintuzumab attaches to CD33 positive cancer cells in a targeted way and delivers actinium Ac 225 to kill them. Venetoclax is in a class of medications called B-cell lymphoma-2 (BCL-2) inhibitors. It may stop the growth of cancer cells by blocking Bcl-2, a protein needed for cancer cell survival. ASTX-727 is a combination of two drugs, cedazuridine and decitabine. Cedazuridine is in a class of medications called cytidine deaminase inhibitors. It prevents the breakdown of decitabine, making it more available in the body so that decitabine will have a greater effect. Decitabine is in a class of medications called hypomethylation agents. It works by helping the bone marrow produce normal blood cells and by killing abnormal cells in the bone marrow. Giving lintuzumab-Ac225 in combination with venetoclax and ASTX-727 may be safe and tolerable in treating patients with newly diagnosed AML and may improve the chance of going into remission and staying in remission for a longer period of time.

Start Date21 Apr 2026

Sponsor / Collaborator

National Cancer Institute

100 Clinical Results associated with Venetoclax

100 Translational Medicine associated with Venetoclax

100 Patents (Medical) associated with Venetoclax

4,939

Literatures (Medical) associated with Venetoclax

01 Jan 2026·BIOCHIMICA ET BIOPHYSICA ACTA-MOLECULAR BASIS OF DISEASE

Metabolic reprogramming represents a targetable mechanism to overcome acquired resistance to venetoclax in acute myeloid leukemia

Article

Author: de Franca Basto Silva, Marina ; Campregher, Paulo Vidal ; Cortez, Luiz Gustavo Ferreira ; Lima, Keli ; Costa-Lotufo, Leticia Veras ; Machado-Neto, João Agostinho ; de Queiroz, Gustavo Nery ; Guedes, Rafael Lucas Muniz ; Câmara, Niels Olsen Saraiva ; Tomaz, Victoria ; Cipelli, Marcella ; Rego, Eduardo Magalhães

Acute myeloid leukemia (AML) often develops resistance to the BCL2 inhibitor venetoclax through metabolic reprogramming. This study established acquired venetoclax-resistant AML models (MV4-11VR and MOLM-13VR) to explore resistance mechanisms and therapeutic strategies. Cell viability and apoptosis assays revealed robust acquired resistance to venetoclax upon intermittent drug exposure. Metabolic profiling revealed distinct adaptations: MV4-11VR cells favored glycolysis, while MOLM-13VR cells increased oxidative phosphorylation. Proteomic analysis supported these findings, showing pathway enrichment for carbohydrate metabolism in MV4-11VR and aerobic energy production in MOLM-13VR. Despite these differences, both models shared hyperactivation of the PI3K/AKT/mTOR pathway, as shown by RPS6 hyperphosphorylation. Apoptotic regulation also diverged between the cellular models in relation to modulated BCL2-related genes and activation of the MAPK signaling pathway. Targeting these metabolic changes with metformin (a mitochondrial complex I inhibitor) or KPT-9274 (a NAMPT inhibitor) re-sensitized resistant cells to venetoclax. Combination treatments showed strong synergy and near-complete cell elimination. These results highlight metabolic reprogramming as a heterogeneous but targetable resistance mechanism and support combining metabolic inhibitors with BCL2 blockade to treat refractory AML.

31 Dec 2025·ANNALS OF MEDICINE

Significant prognostic improvement in elderly patients with acute myeloid leukemia treated with hypomethylating agents and venetoclax: outcomes from a retrospective real-world analysis

Article

Author: Zheng, Jing ; Wu, Yong ; Chen, Yi ; Wu, Lanlan ; Zhou, Jiayi ; Wu, Zhengjun ; Cai, Ruyu ; Wang, Zhengyang

OBJECTIVE:

This investigation aim to analyze the clinical features and therapeutic outcomes of elderly patients with acute myeloid leukemia (AML).

METHOD:

We conducted a retrospective analysis of the clinical and cytogenetic profiles of patients aged 60 years and older diagnosed with AML at the Fujian Medical University Union Hospital from 2016 to 2024.

RESULTS:

Our study cohort included 846 patients, with a median age of 67 years. The median duration of response (DOR) was 15.8 months, with 1-year, 3-year, and 5-year DOR rates of 55.3%, 23.4%, and 13.1%, respectively. The median overall survival (OS) was 21.8 months, with corresponding 1-year, 3-year, and 5-year OS rates of 58.7%, 41.2%, and 30.0%. Patients who received the azacitidine and venetoclax treatment protocol exhibited a complete remission (CR) rate of 57.1% and a minimal residual disease (MRD) - negative rate of 34.1%. These rates were comparable to the 59.2% CR rate and 39.4% MRD-negative rate observed in patients treated with intensive chemotherapy, and were superior to those with other low-intensity regimens. Compared to the treatment outcomes achieved at our center prior to 2016, when chemotherapy was the predominant treatment modality, which were characterized by a CR rate of 42.7%, a median OS of 9.2 months, and a mere 5-year OS rate of 13.5%, the remission rate and long-term survival of elderly patients with AML have been remarkable improved.

CONCLUSION:

The integration of hypomethylating agents and venetoclax into the treatment paradigm for elderly patients with AML has significantly enhanced survival rates.

31 Dec 2025·Hematology

Identification of t(X;1)(q28;q21) generating a novel GATAD2B::MTCP1 gene fusion in CMML and its persistence during progression to AML

Article

Author: Chen, Yu ; Zhu, Yi-yan ; Liu, Yi-zi ; Hou, Chun-xiao ; Zhang, Zhi-yu ; Chen, Su-ning ; Wang, Qian ; Zhang, Feng-hong

OBJECTIVE:

Hematological malignancies often involve chromosomal translocations and fusion genes that drive disease progression. While MTCP1 is well-known in T-cell prolymphocytic leukemia (T-PLL), its role in myeloid neoplasms is less understood. This report presents the first identification of the t(X;1)(q28;q21) translocation leading to the GATAD2B::MTCP1 fusion in acute myeloid leukemia (AML) transformed from chronic myelomonocytic leukemia (CMML).

METHODS:

The karyotypes were described according to the International System for Human Cytogenetic Nomenclature 2009. We performed targeted next-generation sequencing (NGS) on a panel of 172 genes commonly mutated in hematological malignancies (Supplemental Table 1), using an Illumina platform. RNA sequencing was conducted on total RNA extracted from bone marrow, also using the Illumina platform. The GATAD2B::MTCP1 fusion gene was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) and Sanger sequencing, with specific primers for the fusion transcript (GATAD2B-F: CCTCTTTTTTTCGACGCC; MTCP1-R: ACTGAGCACAACACTTACGC).

RESULTS:

The GATAD2B::MTCP1 fusion results from a breakpoint on 1q21 within GATAD2B exon 1 and Xq28 within MTCP1 exon 2. The patient with the GATAD2B::MTCP1 fusion exhibited disease progression from CMML to AML. Despite achieving initial remission with venetoclax-based therapy and allo-HSCT, the patient relapsed and died.

CONCLUSIONS:

We propose that the GATAD2B::MTCP1 fusion upregulates MTCP1 expression rather than generating a fusion protein, thereby contributing to transformation and relapse in AML. Further investigations are needed to elucidate the precise role of this fusion event in myeloid malignancies.

1,210

News (Medical) associated with Venetoclax

22 Dec 2025

·www.einpresswire.com

Breakthrough blood cancer research from UChicago Medicine presented at ASH 2025

UChicago Medicine researchers made a strong impact at the 67th American Society of Hematology (ASH) Annual Meeting, held December 6–9, 2025, in Orlando, Florida. Highlights included innovative early-line applications of CAR T-cell therapy in multiple myeloma, cutting-edge investigations in acute leukemias, outcomes-focused studies in lymphoid and myeloid malignancies, and real-world data on the use of monoclonal antibodies. Faculty and trainees from UChicago Medicine joined international colleagues to share the latest updates from transformative research in blood cancers. Reflecting the breadth and depth of hematology research, the presentations covered novel therapeutic strategies, health services research and translational science. ASH 2025 awards and trainee recognition Three UChicago Medicine trainees were recognized with Abstract Achievement Awards for their contributions spanning survivorship, immunotherapy monitoring and supportive care. Samuel Yates, MD, MS , a two-time Abstract Achievement Award recipient, presented data from the NEOMA trial, an ongoing study testing structured nutrition and exercise during acute lymphoid leukemia (ALL) treatment to optimize muscle and fat composition in adolescent young adult (AYA) patients. He also shared results from another study demonstrating how comprehensive geriatric assessment can help predict treatment and survival outcomes in older adults with acute myeloid leukemia (AML). Abigail Sneider, MD, presented data from a clinical study exploring whether next-generation sequencing of bone marrow following B-cell maturation antigen -directed CAR T-cell therapy could characterize B-cell reconstitution and serve as a complementary diagnostic marker alongside minimal residual disease (MRD) testing in multiple myeloma. Habib El-Khoury, MD, shared findings on treatment-related clonal hematopoiesis in AYA survivors of ALL, highlighting the need to further study the long-term impact of small clonal population on therapy-associated complications. Nada Aboelella, PhD, a postdoctoral fellow in the laboratory of James LaBelle, MD, PhD , Professor of Pediatrics and Director of the Pediatric Stem Cell and Cellular Therapy Program at UChicago Medicine, received both the UChicago Biological Sciences Division Career Advancement for Postdocs Travel Award and the UChicago Medicine Comprehensive Cancer Center Trainee Associate Member Travel Award, to support her attendance at the ASH conference. In an oral presentation, she shared research demonstrating that adding venetoclax, a drug that targets BCL-2, during the CAR T-cell manufacturing process can enhance therapy effectiveness by improving the quality and potency of the final CAR T-cell product. Faculty presentations In a live symposium, Michael Bishop, MD , Professor of Medicine and Director of the Hematopoietic Stem Cell Transplantation Program at UChicago Medicine, joined by Luciano Jose Costa, MD, PhD, from the University of Alabama at Birmingham and Binod Dhakal, MD, MS, from the Medical College of Wisconsin, delivered in-depth analyses on the real-world clinical complications of CAR T-cell therapy in multiple myeloma (MM). Bishop emphasized the feasibility of administering CAR T-cell therapy in an outpatient setting and highlighted the importance of multidisciplinary collaboration to ensure successful outcomes. Megan McNerny, MD, PhD , Associate Professor of Pathology, chaired the session, “ Dissecting enhancer function in hematopoietic development and disease ,” which focused on how cutting-edge approaches like 3D functional genomics, genetic manipulations and computational biology are deepening our understanding of gene regulation in both normal and disease states. Austin Wesevich, MD, MPH, MS , Instructor of Medicine, presented compelling research showing that patients with sickle cell disease (SCD) were more likely to receive negative descriptors in their medical records, such as being labeled as “noncompliant” or “refusing care.” These stigmatizing labels were associated with fewer visits from care providers, longer hospital stays, and a higher likelihood of patients leaving the hospital without any medical advice, highlighting potential disparities in care delivery. In another presentation, he shows that patients with SCD were more likely to be labeled as having “refused” medications, despite physicians being less likely to adjust treatment plans when patients declined medication. It suggests potential bias in how patient decisions are recorded and respected. In an education session, “ Treatment refinement in multiple myeloma ,” Benjamin Derman, MD , Assistant Professor of Medicine, discussed whether maintenance therapy in MM can be safely discontinued using minimal residual disease (MRD)-guided strategies. He highlighted the potential benefits, such as improved quality of life, reduced side effects and better financial management with a practical framework for treatment discontinuation. In a poster session, he shared real-world data comparing the effectiveness of anti-CD38 monoclonal antibody therapies in treatment-naïve patients versus those previously exposed, showing limited benefit with retreatment. He also presented early results from an ongoing Phase II trial indicating high response rates and manageable toxicity using a reduced-intensity quadruplet regimen – belantamab mafodotin, carfilzomib, pomalidomide and dexamethasone in MM patients who relapsed after BCMA CAR T-cell therapy. Anand Patel, MD , Assistant Professor of Medicine and Medical Director, Inpatient Leukemia Service at UChicago Medicine, presented Phase II trial data showing that a tyrosine kinase inhibitor combined with inotuzumab ozogamicin achieved deep MRD-negative remissions in newly diagnosed Philadelphia chromosome–positive ALL, with all patients reaching MRD-negative status by cycle 3 with no major safety concerns. He also shared findings from an ongoing Phase 1b trial evaluating the safety and early efficacy of a combination therapy of ivosidenib and ruxolitinib in patients with advanced IDH1-mutated myeloproliferative neoplasms. Caner Saygin, MD , Assistant Professor of Medicine at UChicago Medicine, presented interim results from an ongoing Phase I/II trial investigating the safety and efficacy of a novel combination therapy – LP-118 (a dual BCL-2/BCL-xL inhibitor), pinatinib, vincristine, and dexamethasone for adults with relapsed/refractory T-ALL/lymphoblastic lympohoma. The regimen targets pre-T-cell receptor-signaling pathways with the goal of improving survival outcomes in this difficult-to-treat population. T-cell engaging (TCE) therapies, including CAR T-cells and bispecific antibodies, have significantly transformed care for patients with B-cell non-Hodgkin lymphoma (B-NHL) because of increasing approvals and use in earlier lines of therapy. In an education session, Sonali Smith, MD , Elwood V. Jensen Professors of Medicine and Chief of the Section of Hematology/Oncology, addressed ongoing challenges with these therapies, such as toxicity, logistical complexity and accessibility. She discussed MRD-based strategies for patient selection and the integration of emerging platforms like CAR-NK and TCR-T cells to expand therapeutic potential. Finally, in a special scientific symposium, Jeffrey Rathmell, PhD , Virginia and D. K. Ludwig Chair and Professor for Cancer Research in University of Chicago's Ben May Department of Cancer Research, discussed how metabolic pathways regulate immune cell function. It focused on mitochondria responses to chronic inflammation and cellular stress – key factors shaping immune system behavior. With thousands of abstracts, live sessions and collaborative learning opportunities, ASH 2025 once again affirmed its role as the world’s leading hematology conference. UChicago Medicine’s robust presence showcased its commitment to advancing the science and clinical care of hematologic diseases through excellence in research, education and innovation. The next ASH Annual Meeting and Exposition will be held December 12–15, 2026, in New Orleans. Legal Disclaimer: EIN Presswire provides this news content "as is" without warranty of any kind. We do not accept any responsibility or liability for the accuracy, content, images, videos, licenses, completeness, legality, or reliability of the information contained in this article. If you have any complaints or copyright issues related to this article, kindly contact the author above.

Clinical ResultCell TherapyASHPhase 2Immunotherapy

22 Dec 2025

·www.globenewswire.com

ORYZON Expands Global Patent Protection for Iadademstat with Grant Decision in Japan Covering Combinations with PD-1/PD-L1 Inhibitors

Key combination for the treatment of Small Cell Lung CancerMADRID and CAMBRIDGE, Mass., Dec. 22, 2025 (GLOBE NEWSWIRE) -- Oryzon Genomics, S.A. (ISIN Code: ES0167733015, ORY), a clinical-stage biopharmaceutical company and global leader in epigenetics, today announced that the Japanese Patent Office has issued a Decision to Grant for its patent application JP2021-557187, entitled “Combinations of iadademstat for cancer therapy”. Following formal grant, the patent is expected to remain in force until at least 2040, excluding any available patent term extensions. With this decision, Oryzon has now secured patent protection for these combinations in Europe, Japan, Australia and Russia, while corresponding patent applications continue to be prosecuted in other countries. “This Japanese grant represents another important milestone in building a robust patent portfolio around iadademstat,” said Neus Virgili, Oryzon’s Chief IP Officer. “It reinforces our strategy to protect the clinical use of iadademstat in combination with immune checkpoint inhibitors such as atezolizumab and durvalumab in small cell lung cancer (SCLC), an approach we are evaluating as part of iadademstat’s ongoing clinical development programs.” Iadademstat is being evaluated in combination with PD-L1 inhibitors (atezolizumab or durvalumab) in first line, extensive-disease SCLC patients in an ongoing Phase I/II trial conducted and sponsored by the U.S. National Cancer Institute (NCI) under a Cooperative Research and Development Agreement (CRADA) with Oryzon. The study is carried out at more than 30 clinical sites across the United States, including leading cancer institutions such as Memorial Sloan Kettering Cancer Center, Johns Hopkins, City of Hope, Yale University and the University of Chicago, among others. About OryzonFounded in 2000 in Barcelona, Spain, Oryzon (ISIN Code: ES0167733015) is a clinical stage biopharmaceutical company and the European leader in epigenetics, with a strong focus on personalized medicine in CNS disorders and oncology. Oryzon’s team is composed of highly qualified professionals from the pharma industry located in Barcelona, Boston, and San Diego. Oryzon has an advanced clinical portfolio with two LSD1 inhibitors, vafidemstat in CNS (Phase III-ready) and iadademstat in oncology/hematology (Phase II). The company has other pipeline assets directed against other epigenetic targets like HDAC-6 where a clinical candidate ORY-4001, has been nominated for its possible development in CMT and ALS. In addition, Oryzon has a strong platform for biomarker identification and target validation for a variety of malignant and neurological diseases. For more information, visit www.oryzon.com About IadademstatIadademstat (ORY-1001) is a small oral molecule, which acts as a highly selective inhibitor of the epigenetic enzyme LSD1 and has a powerful differentiating effect in hematologic cancers (see Maes et al., Cancer Cell 2018 Mar 12; 33 (3): 495-511.e12.doi: 10.1016 / j.ccell.2018.02.002.). A FiM Phase I/IIa clinical trial with iadademstat in R/R AML patients demonstrated the safety and good tolerability of the drug and preliminary signs of antileukemic activity, including a CRi (see Salamero et al, J Clin Oncol, 2020, 38(36): 4260-4273. doi: 10.1200/JCO.19.03250). Iadademstat has shown encouraging safety and strong clinical activity in combination with azacitidine in a Phase IIa trial in elder 1L AML patients (ALICE trial) (see Salamero et al., ASH 2022 oral presentation & The Lancet Haematology, 2024, 11(7):e487-e498). Iadademstat is currently being evaluated in combination with azacitidine and venetoclax in 1L AML in an investigator-initiated study (IIS) led by OHSU and in combination with gilteritinib in the company-sponsored Phase Ib FRIDA trial in relapsed/refractory FLT3-mutant AML, with highly encouraging preliminary safety and efficacy data recently reported at ASH-2025 for both trials: 100% ORR and 90% strict CR in 1L AML, and 67% CCR (at the dose under expansion) in R/R AML. Additional studies in hemato-oncology include an IIS in MDS, and trials in myeloproliferative neoplasms and 1L AML both sponsored by the U.S. National Cancer Institute (NCI) under the Cooperative Research and Development Agreement (CRADA) signed between Oryzon and the NCI to collaborate on further clinical development of iadademstat in different types of hematologic and solid cancers. Beyond hematological cancers, the inhibition of LSD1 has been proposed as a valid therapeutic approach in some solid tumors such as small cell lung cancer (SCLC), neuroendocrine tumors (NET), medulloblastoma and others. In a Phase IIa trial in combination with platinum/etoposide in second line ED-SCLC patients (CLEPSIDRA trial), preliminary activity and safety results have been reported (see Navarro et al., ESMO 2018 poster). Iadademstat is in a Phase I/II randomized trial in 1L ED-SCLC in combination with ICI sponsored by NCI and led by the Memorial Sloan Kettering Cancer Center. In addition, Oryzon is expanding iadademstat’s clinical development into non-oncological hematology indications, with trials in sickle cell disease (approved by EMA, enrolling) and essential thrombocythemia (submitted to EMA). Iadademstat has orphan drug designation for SCLC in the US and for AML in the US and EU. FORWARD-LOOKING STATEMENTSThis communication contains, or may contain, forward-looking information and statements about Oryzon, including financial projections and estimates and their underlying assumptions, statements regarding plans, objectives, and expectations with respect to future operations, capital expenditures, synergies, products and services, and statements regarding future performance. Forward-looking statements are statements that are not historical facts and are generally identified by the words “expects,” “anticipates,” “believes,” “intends,” “estimates” and similar expressions. Although Oryzon believes that the expectations reflected in such forward-looking statements are reasonable, investors and holders of Oryzon shares are cautioned that forward-looking information and statements are subject to various risks and uncertainties, many of which are difficult to predict and generally beyond the control of Oryzon that could cause actual results and developments to differ materially from those expressed in, or implied or projected by, the forward-looking information and statements. These risks and uncertainties include those discussed or identified in the documents sent by Oryzon to the Spanish Comisión Nacional del Mercado de Valores (CNMV), which are accessible to the public. Forward-looking statements are not guarantees of future performance and have not been reviewed by the auditors of Oryzon. You are cautioned not to place undue reliance on the forward-looking statements, which speak only as of the date they were made. All subsequent oral or written forward-looking statements attributable to Oryzon or any of its members, directors, officers, employees, or any persons acting on its behalf are expressly qualified in their entirety by the cautionary statement above. All forward-looking statements included herein are based on information available to Oryzon on the date hereof. Except as required by applicable law, Oryzon does not undertake any obligation to publicly update or revise any forward‐looking statements, whether as a result of new information, future events, or otherwise. This document does not constitute an offer or invitation to purchase or subscribe shares in accordance with the provisions of Regulation (EU) 2017/1129 of the European Parliament and of the Council of 14 June 2017, and/or the restated text of the Securities Market Law, approved by Law 6/2023 of 17 March, and its implementing regulations. Nothing in this document constitutes investment advice. In addition, this document does not constitute an offer of purchase, sale or exchange, nor a request for an offer of purchase, sale or exchange of securities, nor a request for any vote or approval in any jurisdiction. The shares of Oryzon Genomics, S.A. may not be offered or sold in the United States of America except pursuant to an effective registration statement under the Securities Act of 1933 or pursuant to a valid exemption from registration.. Spain Oryzon IR & Media, Europe & US Patricia Cobo/Mario Cordera Emili Torrell Sandya von der Weid Atrevia Chief BD Officer LifeSci Advisors, LLC +34 91 564 07 25 +34 673 33 97 65 +34 93 515 1313 +41 78 680 05 38 pcobo@atrevia.com mcordera@atrevia.com etorrell@oryzon.com svonderweid@lifesciadvisors.com

Phase 2Orphan DrugClinical ResultPhase 1

22 Dec 2025

·www.globenewswire.com

FDA approves Roche’s Lunsumio VELO™ for subcutaneous use in relapsed or refractory follicular lymphoma

Lunsumio VELO reduces administration time from 2-4 hours to approximately one minuteAvailability of Lunsumio VELO allows treatment aligned to people’s clinical needs and personal preferences Approval supported by data demonstrating compelling complete response rate in third-line or later follicular lymphoma, which typically becomes harder to treat after each relapse1,2 Basel, 22 December 2025 - Roche (SIX: RO, ROG; OTCQX: RHHBY) announced today that the US Food and Drug Administration (FDA) has approved CD20xCD3 bispecific Lunsumio VELO™ (mosunetuzumab), as a subcutaneous (SC) formulation, for the treatment of adult patients with relapsed or refractory (R/R) follicular lymphoma (FL) after two or more lines of systemic therapy, based on results from the phase I/II GO29781 study.1 Based on the study results, Lunsumio VELO is approved under accelerated approval. Full approval for this regimen may be contingent on verification and confirmation of benefit in a confirmatory trial. “Since follicular lymphoma often requires lifelong management, reducing the burden of care for these individuals is of paramount importance,” said Levi Garraway, MD, PhD, Roche’s Chief Medical Officer and Head of Global Product Development. “With this FDA approval, treatment can now be administered in just one minute, which significantly reduces the time patients spend in the clinic and helps to align care with their individual needs and preferences.” Lunsumio VELO reduces treatment administration time with an approximately one-minute injection, compared with a 2-4 hour intravenous (IV) infusion. Like Lunsumio administered intravenously, Lunsumio VELO can be administered outpatient and is a fixed-duration treatment given for a defined period, which could be as short as six months. By contrast, treat-to-progression treatment options are designed to be given to patients indefinitely until disease progression or until treatment can no longer be tolerated. “This approval is a significant step in broadening access to effective treatments for people living with follicular lymphoma,” said Dr Ian Flinn, MD, PhD, Tennessee Oncology and One Oncology. “With its manageable cytokine release syndrome profile and reduced administration time, Lunsumio VELO enables oncologists to deliver advanced care in community practice settings.” The FDA approval is supported by the primary analysis of the GO29781 study that evaluated Lunsumio VELO in patients with third-line or later (3L+) FL. Results showed the objective response rate and complete response rate in patients treated with Lunsumio VELO were 75% (95% confidence interval [CI]: 64–83%) and 59% (95% CI: 48–69%), respectively.1 The median duration of response was 22.4 months (95% CI: 16.8–22.8).1 The most common adverse reactions (≥20%) were injection site reactions, fatigue, rash, cytokine release syndrome (CRS), COVID-19 infection, musculoskeletal pain and diarrhoea.1 The CRS rate was 30% and events were mostly low grade (Grade 1–2, 28%; Grade 3, 2.1%), occurred during Cycle 1, and all resolved after a median duration of two days (range: 1–15).1 CRS can be severe and life-threatening. Lunsumio IV was the first bispecific antibody approved for 3L+ FL. Long-term data from the SC and IV arms of the GO29781 study were presented at the 67th American Society of Hematology Annual Meeting and Exposition. These data have been submitted to other healthcare authorities around the world. Recently, the European Commission granted conditional marketing authorisation of Lunsumio SC for the treatment of adult patients with R/R FL after two or more lines of systemic therapy. Roche continues to advance its bispecific antibody programme in lymphoma, with ongoing phase III studies evaluating Lunsumio and Lunsumio VELO in earlier lines of treatment. This includes the SUNMO study investigating Lunsumio VELO in combination with Polivy® (polatuzumab vedotin) in second-line or later large B-cell lymphoma, and the MorningLyte study investigating Lunsumio VELO in combination with lenalidomide in previously untreated FL. About the GO29781 study The GO29781 [NCT02500407] study is a phase I/II, multicentre, open-label, dose-escalation and expansion study evaluating the safety, efficacy and pharmacokinetics of mosunetuzumab administered both as an intravenous (IV) and subcutaneous (SC) treatment, in people with relapsed or refractory B-cell non-Hodgkin lymphoma. The efficacy of Lunsumio VELO™ (mosunetuzumab) was established on the basis of objective response rate and duration of response. About follicular lymphomaFollicular lymphoma (FL) is the most common slow-growing (indolent) form of non-Hodgkin lymphoma, accounting for about one in five cases.3,4 It typically responds well to treatment but is often characterised by periods of remission and relapse.3,4 The disease typically becomes harder to treat each time a patient relapses and early progression can be associated with poor long-term prognosis.2 It is estimated that more than 110,000 people are diagnosed with FL each year worldwide.4,5 About Lunsumio VELO™ (mosunetuzumab)Lunsumio VELO is a subcutaneous formulation of mosunetuzumab, a CD20xCD3 T-cell-engaging bispecific antibody designed to target CD20 on the surface of B cells and CD3 on the surface of T cells. This dual-targeting activates and redirects a patient’s existing T cells to engage and eliminate target B cells by releasing cytotoxic proteins into the B cells. Lunsumio VELO is being investigated as a monotherapy and in combination with other medicines, for the treatment of people with B cell non-Hodgkin lymphomas, including follicular lymphoma, large B-cell lymphoma, and other indications. About Roche in haematologyRoche has been developing medicines for people with malignant and non-malignant blood diseases for more than 25 years; our experience and knowledge in this therapeutic area runs deep. Today, we are investing more than ever in our effort to bring innovative treatment options to patients across a wide range of haematologic diseases. Our approved medicines include MabThera®/Rituxan® (rituximab), Gazyva®/Gazyvaro® (obinutuzumab), Polivy® (polatuzumab vedotin), Venclexta®/Venclyxto® (venetoclax) in collaboration with AbbVie, Hemlibra® (emicizumab), PiaSky® (crovalimab), Lunsumio® (mosunetuzumab administered intravenously), Lunsumio SC/VELO™ (mosunetuzumab administered subcutaneously) and Columvi® (glofitamab). Our pipeline of investigational haematology medicines includes T-cell-engaging bispecific antibody cevostamab, targeting both FcRH5 and CD3, and Tecentriq® (atezolizumab). Our scientific expertise, combined with the breadth of our portfolio and pipeline, also provides a unique opportunity to develop combination regimens that aim to improve the lives of patients even further. About Roche Founded in 1896 in Basel, Switzerland, as one of the first industrial manufacturers of branded medicines, Roche has grown into the world’s largest biotechnology company and the global leader in in-vitro diagnostics. The company pursues scientific excellence to discover and develop medicines and diagnostics for improving and saving the lives of people around the world. We are a pioneer in personalised healthcare and want to further transform how healthcare is delivered to have an even greater impact. To provide the best care for each person we partner with many stakeholders and combine our strengths in Diagnostics and Pharma with data insights from the clinical practice. For over 125 years, sustainability has been an integral part of Roche’s business. As a science-driven company, our greatest contribution to society is developing innovative medicines and diagnostics that help people live healthier lives. Roche is committed to the Science Based Targets initiative and the Sustainable Markets Initiative to achieve net zero by 2045. Genentech, in the United States, is a wholly owned member of the Roche Group. Roche is the majority shareholder in Chugai Pharmaceutical, Japan. For more information, please visit www.roche.com. All trademarks used or mentioned in this release are protected by law. References[1] Roche data on file. [2] Fowler NH, at al. Moving T-Cell Therapies into the Standard of Care for Patients with Relapsed or Refractory Follicular Lymphoma: A Review. Targ Oncol. 2024;19:495–510.[3] Adult Non-Hodgkin Lymphoma Treatment-Health Professional Version (PDQ®) National Cancer Institute [Internet; cited December 2025]. Available from: https://www.cancer.gov/types/lymphoma/hp/adult-nhl-treatment-pdq#link/_552_toc.[4] Cancer.Net. Lymphoma - Non-Hodgkin: Subtypes. [Internet; cited December 2025]. Available from: https://www.cancer.net/cancer-types/lymphoma-non-hodgkin/subtypes.[5] World Health Organization. Numbers derived from GLOBOCAN 2022. Non-Hodgkin Lymphoma Factsheet [Internet; cited December 2025]. Available from: https://gco-iarc-who-int.libproxy1.nus.edu.sg/media/globocan/factsheets/cancers/34-non-hodgkin-lymphoma-fact-sheet.pdf. Roche Global Media RelationsPhone: +41 61 688 8888 / e-mail: media.relations@roche.com Hans Trees, PhDPhone: +41 79 407 72 58Sileia UrechPhone: +41 79 935 81 48 Nathalie AltermattPhone: +41 79 771 05 25Lorena CorfasPhone: +41 79 568 24 95 Simon GoldsboroughPhone: +44 797 32 72 915Karsten KleinePhone: +41 79 461 86 83 Kirti PandeyPhone: +49 172 6367262Yvette PetillonPhone: +41 79 961 92 50 Dr Rebekka SchnellPhone: +41 79 205 27 03 Roche Investor Relations Dr Bruno EschliPhone: +41 61 68-75284e-mail: bruno.eschli@roche.comDr Sabine BorngräberPhone: +41 61 68-88027e-mail: sabine.borngraeber@roche.com Dr Birgit MasjostPhone: +41 61 68-84814e-mail: birgit.masjost@roche.com Investor Relations North America Loren KalmPhone: +1 650 225 3217e-mail: kalm.loren@gene.com Attachment Media Investor Release Lunsumio VELO FDA Approval English

Clinical ResultDrug ApprovalPhase 3ASH

100 Deals associated with Venetoclax

External Link

KEGG	Wiki	ATC	Drug Bank
D10679	Venetoclax	L01XX52	DB11581

R&D Status

Approved

10 top approved records.

to view more data

Indication	Country/Location	Organization	Date
Mantle cell lymphoma recurrent	Japan	AbbVie LLC	27 Mar 2025
Mantle cell lymphoma refractory	Japan	AbbVie LLC	27 Mar 2025
Chronic lymphocytic leukaemia refractory	Japan	AbbVie LLC	20 Sep 2019
Recurrent Chronic Lymphoid Leukemia	Japan	AbbVie LLC	20 Sep 2019
Small Lymphocytic Lymphoma	United States	AbbVie, Inc.	08 Jun 2018
Adult Acute Myeloblastic Leukemia	European Union	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Iceland	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Liechtenstein	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Adult Acute Myeloblastic Leukemia	Norway	AbbVie Deutschland GmbH & Co. KG	04 Dec 2016
Acute Myeloid Leukemia	Canada	AbbVie AS	31 Oct 2016
Chronic Lymphocytic Leukemia	United States	AbbVie, Inc.	11 Apr 2016

Developing

10 top R&D records.

to view more data

Indication	Highest Phase	Country/Location	Organization	Date
Tumor Lysis Syndrome	Phase 3	United States	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Australia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	France	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Greece	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Serbia	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Spain	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	Taiwan Province	AbbVie, Inc.	05 Aug 2024
Tumor Lysis Syndrome	Phase 3	United Kingdom	AbbVie, Inc.	05 Aug 2024
Relapsing acute myeloid leukemia	Phase 3	United States	AbbVie, Inc.	01 Oct 2022
Relapsing acute myeloid leukemia	Phase 3	United States	Genentech, Inc.	01 Oct 2022

Clinical Result

Indication

Phase

Evaluation

View All Results

Study	Phase	Population	Analyzed Enrollment	Group	Results	Evaluation	Publication Date


NCT05536349 (ASH2025)	Phase 2	Chronic Lymphocytic Leukemia First line	77	ObinutuzumabVenetoclaxnib 200mg + ObinutuzumabVenetoclax + ObinutuzumabVenetoclaxab	zwajhkurmm(koffhxrpny) = ghyencpssm uvxrgzuwjt (cjkgpctahr ) View more	Positive	06 Dec 2025
				-	zwajhkurmm(koffhxrpny) = vdxvvqwips uvxrgzuwjt (cjkgpctahr ) View more
NCT05292664 (DFCI 21-757, ASH2025)	Phase 1	Acute Lymphoblastic Leukemia \| Mixed phenotype acute leukemia	9	Venetoclax + multiagent chemotherapy	qcgipcehwr(uopwuwszrh) = febrile neutropenia (6), hypertension (3), anorexia (2), hyperglycemia (2), mucositis (2), and sepsis (2). calcrvbznt (kiemycvnwo ) View more	Positive	06 Dec 2025
ASH2025	Not Applicable	Acute Myeloid Leukemia	6	FLAG-IDA-Ven (high-risk AML + underwent stem cell transplantation)	bbvwmyfcqs(cyvwjjujgo) = gljdzlxuex mxcepoqjlz (xehtsnabja ) View more	Positive	06 Dec 2025
S2005 (ASH2025)	Phase 2	Waldenstrom Macroglobulinemia First line	82	Ibrutinib+Rituximab	njuwwitxxn(dcetnvcrgv) = dciectjsil xahhxtbwrk (gmqzvdwnzz ) View more	Positive	06 Dec 2025
				Venetoclax+Rituximab	axtjyyftbk(gfpsoynimx) = lpkasaiegz akyepvcsbz (pypshntwfn ) View more
ASH2025	Not Applicable	Acute Myeloid Leukemia CBFB::MYH11 \| RUNX1::RUNX1T1	53	Venetoclax+HMA (CBFB::MYH11)	ghjkkptpem(iymlrtpdtw) = iwcnbftweh axnkcekaxl (ivwajzlbet ) View more	Positive	06 Dec 2025
				Venetoclax+HMA (RUNX1::RUNX1T1)	ghjkkptpem(iymlrtpdtw) = ljgzdayaix axnkcekaxl (ivwajzlbet ) View more
ASH2025	Not Applicable	Acute Myeloid Leukemia First line	65	Discontinuation of HMA and/or VEN	wdzfvneotb(ghuwtsgfpy) = uniazymljs iiyysmegik (qzgklodfgm ) View more	Positive	06 Dec 2025
				No discontinuation of HMA-VEN	vqbnqvymqf(psokyqifpf) = uexpymrcqr nraeriomwf (xedwfrlvpg )
ASH2025	Not Applicable	Acute Myeloid Leukemia	1,093	Venetoclax with hypomethylating agents (70-74)	wdmcetjkzk(qowkomtrrp) = fjfasgjuek aghokxnmbg (vfldiyqnov, 10.2 - 12.0) View more	Positive	06 Dec 2025
				Venetoclax with hypomethylating agents (75-79)	wdmcetjkzk(qowkomtrrp) = uvvexskrqg aghokxnmbg (vfldiyqnov, 10.2 - 14.7) View more
NCT05016947 (ASH2025)	Phase 1	CD22 positive Acute Lymphoblastic Leukemia CD22-positive	22	Venetoclax (VEN) + Inotuzumab ozogamicin (INO)	babuhxvkfz(vwdyjhqedg) = While baseline CD22 MFI did not predict persistent MRD positivity (p=0.53), scRNA-seq analysis of six baseline specimens revealed in patients with MRD positivity reduced baseline expression of lymphoid transcription factors RUNX3 (log2 fold change or L2FC -6.5, adj. p-value <10-4) and IKZF2 (L2FC -5.3, adj. p-value <10-3) as well as multiple Reactome pathways annotated for cell cycling and B-cell receptor (BCR) signaling (normalized enrichment scores or NES <-1.5, adj. p-values <10-3). Flow cytometry revealed a reduction in CD22 MFI of 69.3% and 64.5% at the time of disease progression compared to baseline, corresponding with a reduction in CD22 expression by single-cell RNA-seq (p=0.0018). hqnwmgaktq (gmhuylzycu ) View more	Positive	06 Dec 2025
ASH2025	Not Applicable	Waldenstrom's macroglobulinaemia refractory	91	Venetoclax	hfafcghaao(lyzvjjontm) = mlyoffwfck rcjcymqavz (jidorakhcn ) View more	Positive	06 Dec 2025
				Pirtobrutinib	hfafcghaao(lyzvjjontm) = tcfncsnyrq rcjcymqavz (jidorakhcn ) View more
ASH2025	Not Applicable	Acute Myeloid Leukemia	1,166	cytarabine-based intensive chemotherapy (IC)	tppeislwac(qlflokbmvd) = ybkiodiyxy gvcnylepdn (kbjbjmpbna, 8.5 - 10.3) View more	Positive	06 Dec 2025
				venetoclax combinations (VC)	tppeislwac(qlflokbmvd) = pmvlstlmvr gvcnylepdn (kbjbjmpbna, 6.4 - 8.4) View more

Translational Medicine

Boost your research with our translational medicine data.

view full example data

Deal

Boost your decision using our deal data.

view full example data

Core Patent

Boost your research with our Core Patent data.

view full example data

Clinical Trial

Identify the latest clinical trials across global registries.

view full example data

Approval

Accelerate your research with the latest regulatory approval information.

view full example data

Regulation

Understand key drug designations in just a few clicks with Synapse.

view full example data

AI Agents Built for Biopharma Breakthroughs

Accelerate discovery. Empower decisions. Transform outcomes.

Get started for free today!

Accelerate Strategic R&D decision making with Synapse, PatSnap’s AI-powered Connected Innovation Intelligence Platform Built for Life Sciences Professionals.

Start your data trial now!

Synapse data is also accessible to external entities via APIs or data packages. Empower better decisions with the latest in pharmaceutical intelligence.

Bio

Bio Sequences Search & Analysis

Chemical

Chemical Structures Search & Analysis